INTRODUCTION

Electrophoresis is a method for separating charged particles under an electric field. Electrophoresis, in its various forms or types, has become the most widely used method for analyzing biological molecules in biochemistry or molecular biology, including genetic components such as DNA or RNA, proteins, and Polysaccharides [1] [2]. The high-precision of electrophoresis has made it an important tool for advancing biotechnology [3]. Agarose gel electrophoresis is a form of electrophoresis used to separate DNA fragments based on their size [4]. Under the influence of an electric field, fragments will migrate to either the cathode or the anode, depending on the nature of their net charge. It is the most common means of separating moderate to large-sized nucleic acids and has a wide range of separations [5]. And an effective method for separating, identifying, and purifying 0.5 to 25 kb DNA fragments. It is known that the mobility is independent of the size of DNA with the size ~400 base pairs (bp) and larger, and it varies with the ionic strength of the electrolyte solution used [6]. The development of gel electrophoresis as a method for separating and analyzing DNA has been a driving force in the revolution of molecular biology over the past 20 years [7]. These techniques are now used by thousands of researchers and laboratory workers. More than half of all scientific papers published in biochemistry currently rely on electrophoresis methods [8]. In principle, understanding DNA gels conceptually is easy and technically feasible. In practice, many small details affect the accuracy and repeatability of the results [7]. The electrophoresis of Agarose gel is typically carried out using either Tris acetate EDTA (TAE) or Tris boric acid EDTA (TBE) buffers [9]. Research has identified other effective solutions compared to the mentioned buffers, with sodium bicarbonate being one of the most important due to its wider availability and much lower cost than other buffers [10]. Many researchers have studied alternatives to gel agarose that are less costly, these studies have included: gelatin, agar, and corn starch [11] [12] [13].The use and study of plant-based gel has not been sufficiently explored in previous research, so we focused on this type of gel in our study as it can be more easily and readily sourced than agar gel and is relatively cheaper. It can be concluded that the effective use of plant-based gel may lead to a wider range of electrophoresis application.

MATERIALS AND METHODS

Preparation of 1 L of 1X TAE buffer from 40X stock In DNA-related biological experiments, buffers are used to maintain a constant physiological pH. The electrophoretic mobility of DNA has been found to be strongly buffer dependent with TAE buffer pH for DNA fragments being ]15[ ]14[ 8.0. A volume of 50 mL of 40X TAE (Promega®) was measured into a 2 L beaker and was topped up with 1950 mL of distilled water to obtain a working solution of 1X TAE. Preparation of agarose gel (positive control) Agarose, a strongly gelling polysaccharide, is a common ingredient used to optimize the viscoelastic properties of a multitude of food products. This polymer is composed of a repeating disaccharide unit called agarobiose, which consists of galactose and 3,6-anhydrogalactose [16] [17]. The concentration of agarose in a gel depends on the size of the DNA fragments, which are separated with most gels ranging from %0.5 to ]19[ ]18[ %2. 1 g of electrophoresis-grade agarose (Vinantis®) was added to 100 ml of electrophoresis buffer. The gel was then prepared by melting the agarose in a microwave oven or autoclave and swirling to ensure even mixing. Melted agarose should be cooled to 50-60°C under running tap water before pouring it onto the gel cast. Gels are typically poured between 0.5 and 1 cm thick. The volume of the sample wells is determined by both the thickness of the gel and the size of the gel well [20]. Preparation of corn starch gel To prepare boric acid and sodium hydroxide buffers, corn starch was modified by adding amount of 1.855 g of boric acid and 0.48 g of NaOH, which were added to a 1 L beaker containing 200 ml of distilled water and stirred to homogeneity. We added 36 g of corn starch to the mixture and topped up with distilled water to the 1 L mark. The solution was stirred very well and allowed to stand in a water bath at 50 °C for 30 min. the supernatant was discarded, and the precipitant was kept. Next, 30 ml of distilled water was added to the precipitant and stirred to homogeneity, and then the Beecher was set in a water bath until it was dried. The modified dry starch was then ground until it became powder. An amount of 12 g of the modified corn starch was weighed and added to a beaker containing 100 ml of 1X TAE and the beaker was placed in a water bath until boiling. The supernatant was discarded, and the precipitant was taken and poured into the gel cast with the combs in place, and left until it solidified [13]. Preparation of Animal gelatin gel An amount of 1 g of animal gelatin powder was weighed and added to a beaker containing 100 ml of 1X TAE buffer. It was mixed well and microwaved for 2 minutes, with stopping every 30 s to gently mix it. The solution was cooled underwater. The gel was then poured into the gel cast. This protocol is commonly used in research. Preparation of an agar–animal gelatin gel mixture An amount of Agar (0.5 g) and animal gelatin (0.5 g) were weighed and added to a beaker containing 100 ml of 1X TAE buffer. The remaining steps are as mentioned in the animal gelatin gel. Preparation of %1 Agar gel An amount of 1 g of Agar was weighed and added to a beaker containing 100 ml of 1X TAE buffer. The remaining steps are identical to those for animal gelatin gel. Preparation of 1 L of sodium bicarbonate (SB) buffer Sodium borate is a Tris-free buffer with low conductivity. Therefore, gels can be run at higher voltages. SB produces sharp bands and nucleic acids can be purified for all downstream applications. However, SB is not as efficient as Tris-based buffers for resolution bands larger than 5 kb. Under standard electrophoretic conditions, SB provided resolution and separation as good as or better than TBE and TAE gels [21] [22]. A volume of 2 g of sodium bicarbonate, 0.12 g of NaOH and 0.05 g of NaCl was poured into a 1 L beaker and was topped up with 1 L of water to obtain a working solution of SB buffer [10]. Preparation of 1.5 % food grade agar-agar gelatin gel An amount of 3.75 g of food grade agar-agar gelatin powder was weighed and added to a beaker containing 250 mL of SB buffer. It was mixed well and microwaved for 2 minutes, with stopping every 30 seconds to gently mix it to avoid bubbles. The solution was cooled underwater. The gel was then poured into the gel cast. A 15 well comb was inserted, and the gel was left to solidify. The comb was gently removed, and the gel was placed in a horizontal gel tank. Sodium bicarbonate buffer was added to the gel tank at the maximum mark. Loading samples into modified corn starch %1 gel and agar – animal gelatin mixture %1 gel Loading ten microliters (10 µl) of human genomic samples [23] [24] after mixing them with 3 microliters (3 µl) of loading dye for all wells. The gel was placed in the tank containing 1X TAE buffer, passed through an electric current of 60 V for 5 minutes and then increased to 95 V for 1 hour. Afterward the gel was removed from the horizontal gel tank and dyed in Ethidium Bromide for 30 minutes because ethidium bromide (EtBr) is sometimes added to the running buffer during the separation of DNA fragments by agarose gel electrophoresis. It is used because when the molecule is bound to the DNA and exposed to a UV light source [25], Ethidium binds strongly to both DNA and RNA at sites that appear to be saturated when one drug molecule is bound for every 4 or 5 nucleotides [26]. It is then transferred to a tank of water with mild shaking for washing for 2 minutes. The gel was removed and viewed using a gel documentation device (UVP BioDoc-It). Loading Samples and Electrophoresis The DNA molecular weight standard control, also called the DNA marker (Ladder), the DNA ladder was separated by conventional agarose gel electrophoresis [27] [28]. Loading 10µL of human genomic samples after mixing them with 3µL of loading dye for wells 3 ,2 ,1 and 4, and 3µL of 50 bp DNA Ladder (vivantis®) in the fifth well. The electrophoresis involved the following steps: First, the voltage was 30 V for 5 minutes, the volt was increased to 45 V for 5 minutes, then to 60 V for 5 minutes, then to 70 V for 10 minutes, then to 90 V for 1 hour and a half (1.5 h). At the end, the voltage was increased to 95 V for 45 minutes in order to avoid DNA escaping from the wells. The gel was removed from the horizontal gel tank and dyed in Ethidium Bromide for 30 minutes and then transferred to a tank filled with washing water for 2 minutes. The gel was removed and viewed using a gel documentation device (UVP BioDoc-It). This protocol was performed for the %1 agarose gel and %1.5 treated food grade agar-agar gel.

RESULTS

Electrophoresis was performed for human genome samples, and a ladder of agarose gel with TAE solution was used as a control for the studied samples: Corn starch gel with TAE solution, agarose gel with TAE solution, animal gelatin with TAE solution, agar with TAE solution, agar – animal gelatin mixture with TAE solution, and food grade agar-agar gelatin with a solution of sodium bicarbonate sodium hydroxide and sodium chloride. All experiments were carried out under similar conditions of pH and using the same equipment and tools. Many aspects were compared during the experiment on a repetitive level, and a mean of duration of solidification, texture, color, dye duration and other parameters are mentioned in Table1.

From Figure 1 we find that the animal gelatin gel (c) forms a surface ice layer and is not fully hardened. One of the reasons for this is the very low heat and low concentration of animal gelatin. Corn starch gel (B) gave a white color and similar properties in terms of the structure with agarose gel. Other gels gave properties in structure and color very similar to agarose gel.

Before the samples were exposed to UV radiation, we can see from Figure 2 that the loading dye was electrophoresed for a distance of 1.2 cm in corn starch gel (A), for a distance of 1.7 cm in agar – gelatin mixture gel (B), for a distance of 0.9 cm for the loading dye and 1.3 cm for the Ladder in agar gel (C), for a distance of 1.4 cm for the loading dye and 1.7 cm for the Ladder in agarose gel (D), for a distance of 1.2 cm for the dye and 1.7 cm for the Ladder in treated food grade agar – agar gel (E) at the voltage and time shown in Table 1 for each gel mentioned. After the electrophoresis of 12% modified corn starch gel, 1% agar – animal gelatin mixture gel, 1% agar gel, 1% agarose gel, and 1.5 % of our treated food grade agar-agar gel with BS buffer, a separation of DNA was apparent, as shown in Figure 3, the modified Gel that is annotated with (E) in the Figure 3 shows good separation of the 50 bp DNA ladder (Vivantis®) in the 5th well, and the 4th well in E is genomic DNA extracted from human saliva. As for agarose gel D in Figure 3, good separation occurred in the 5th well and it showed resemblance to agarose gel in C. The gels were exposed to ultraviolet radiation and examined; we noticed that the disappearance of the fluorescence from the treated food grade agar-agar gel after 15 minutes, while the agarose retained its fluorescence for 25 minutes before the bands vanished from the UV. Knowing that the gels were dyed with the same type and concentration of dye and duration of time. For an electrophoresis buffer consisting of sodium bicarbonate, sodium hydroxide, and sodium chloride, it has shown high efficiency in securing the ions needed for electrophoresis while maintaining its physical and chemical properties; thus, it can be considered an equivalent solution to TAE solution. These results demonstrate the effectiveness of this variant using human genomic DNA. Electrophoresis with a ladder marker gave good results and good separation, as shown in Figure 4, which displays a comparison between agarose 1.5% and the treated food grade agar-agar gel 1.5%, where 5 µl of the marker was loaded into the wells in both gels at 40 V for 5 minutes and 80 V for 2 h followed by 30 minutes of soaking in an ethidium bromide tank. The results showed acceptable efficiency for the treated food-grade agar-agar similar to the efficiency of the agarose gel with some modifications in the method of work. Further enhancements of the images using gel documenting software could even make the separation look clearer for the treated food-grade agar -agar gel.

DISCUSSION

This research addressed finding a frugal alternative for agarose used in agarose gel DNA electrophoresis. The alternatives experimented in this research included: Agar, which originated in Japan in 1658. It was first introduced in the Far East and later in the rest of agarophyte seaweed-producing countries ^[29]. Agar is obtained from various genera and species of red–purple seaweeds—class Rhodophyceae—where it occurs as a structural carbohydrate in the cell walls and probably also plays a role in ion-exchange and dialysis processes ^[30]. Agar is a natural polymer commonly used in various fields of application, ranging from cosmetics to the food industry ^[31]. It is a gel forming polysaccharide with a main chain consisting of alternating 1,3-linked β-d-galactopyranose and 1,4-linked 3,6 anhydro-α-l-galactopyranose units ^[32]. Agarobiose is the basic disaccharide structural unit of all agar polysaccharides. Agar can be fractionated into two components: agarose and agaropectin ^[33]. The food-grade agar results were similar to agar results, yet microbiological agar can be more costly compared to food-grade agar-agar, and the treatment of agar with different salts described in this method gave slightly better results from previous research ^[12]. We also tested Starch, which is a major food source for humans. It is produced in seeds, rhizomes, roots, and tubers in the form of semi-crystalline granules with unique properties for each plant ^[34]. Edible and industrial corn starch was modified and used to prepare the electrophoresis gel. Corn starch is composed of two large α-linked glucose-containing polymers. Namely, smaller and nearly linear amylose and very large and highly branched amylopectin ^[35]. The starch alternative gel didn’t give good results and it was difficult to handle and too thick, so no DNA bands appeared ^[13]. Another alternative tested was Gelatin, which is a protein obtained by partial hydrolysis of collagen, which is the chief protein component in the skin, bones, hides, and white connective tissues of the animal body ^[36]. We can conclude from the gelatin gel result that it is not a good candidate for DNA gel electrophoresis, and this has been the case since the late 1980s.^[11] From the results shown in Fig. 1, we can conclude that modifying the materials concentration allows us to control the structural and solidification properties. It is important to consider the appropriate gel concentration for the gel’s retinal structure, which is where electrophoresis samples pass, and this is in accordance with Bertasa et al. 2020 research that describes a stronger gel formation and crosslinks with increasing the concentration and anhydro units in the gel in addition to alterations of appearance and color, yet this didn’t apply to gelatin and starch where gelatin lacked the strength to solidify and the starch was too thick and difficult to handle after pouring because it solidified very quickly. ^[37] We can observe that the previously mentioned gels in Fig. 2 resulted in the electrophoresis of dyes at least, and this is logical because these gels create a charge neutral trap for the negatively charged loading dye to pass through in the presence of an electric field and an electrolyte. ^[38] From our results shown in Table 1, treated food grade agar-agar gel prepared with sodium bicarbonate solution was the most closely related alternative to the commonly used agarose gel with modifications in the working method to achieve very close results with agarose, while starch gel failed to give a proper result. Also, the mixture didn’t give a clear result because the DNA samples couldn’t get out of the wells. Agar gel, the same as agar – agar gel, gave results similar to those of agarose. But still, treated agar – agar gel showed better results than agar gel by the distance crossed by the DNA samples and the display of the samples, in addition to the low cost. This result of genomic DNA electrophoresis is well known and is confirmed by several previous researches, such as Green et al. 2019, where large genomic DNA fragments migrate slower than smaller fragments, and smearing marks in the resulting gel image refer to poor-quality DNA or electrophoresis conditions. ^[39] As for cost, 1 g of agarose costs around 35,000 Syrian pounds, while 1 g of agarose costs almost 2000 Syrian pounds, while 1 L of TBE 1x costs nearly 700,000 Syrian pounds, while SB buffer roughly costs 3500 Syrian pounds for the same amount, this makes this alternative 15 times cheaper than agarose gel, and 200 times cheaper for the electrolyte used. It seems from Fig. 4 that the treated food grade agar-agar can show strong bands from the ladder, and the separation requires more time; hence, it could be recommended to use it for PCR products of one band and a ladder with several strong bands, and the background fluorescence from ethidium bromide on the treated gel could mean that there should be more rinsing time for it, in order to give clearer bands.

Conclusions and Recommendations

This study offers a very low-cost alternative to agarose gel to help laboratories with limited income. We found that treated food grade agar-agar could give similar results to those of agarose gel, and by using other buffers for electrolyte like SB buffer. Based on the results of this study, this method provides a low-cost alternative to agarose and TBE & TAE, and it can be used by low-budget labs with limited budgets to make DNA assays more domesticated, where the alternatives suggested here cost 15 times less than the industrial agarose and electrolytes. Further research is recommended to enhance the clarity of the gel and explore the potential applications of this new gel in RNA separation and plasmid DNA separation and PCR amplicons of different lengths.

INTRODUCTION

Our modern age is characterized by rapid and tremendous development in science and technology. Each learner has a smartphone and accessing the internet has become a daily need, a habit for some of us, and a source of income for others. And the development of (5G) networks that revolutionized technology and social networking for people and devices “Internet of Things”. This has led to the imposition of modern requirements to prepare the individual to keep pace with the developments of this era in all the fields related to our lives. One of the most important fields is education, especially in mathematics because of its importance in the different fields of life, computer science and especially algorithms. With the advent of technology, mathematical technologies appeared in education and proved their feasibility; the use of technological innovations in teaching math prepares learners for a High-Tech centric world and develops higher mental cognitive skills, such as problem-solving, thinking, data collecting, analysis and proof. Which fall within the scope of creativity and invention [1]. Fields of mathematical technology have diversified following the technological development of computers, mobile phones and the software used in them in addition to other technologies such as interactive whiteboards, the spread of the Internet and the educational services and platforms it provides. Mathematicians were able to use all these technologies in teaching mathematics. The benefits of mathematical technology are not just for students, it has an impact on teachers as it supports the creativity of teachers as learners and task designers and provides the opportunity to develop many new mathematical meanings [2]. Several scholars have investigated the technological pedagogical content knowledge (TPACK) for math teachers. Alternatively, a subset of them: Mailizar and Fan (2019) investigated Indonesian math teachers’ technological pedagogical content knowledge. The study used a questionnaire, and the sample consisted of (341) math teachers. The results showed that the understanding of mathematical technology ranked low and suggested more training courses for teachers [3]. In Malaysia, Bakar, Maat and Rosli’s (2020) study aimed to determine the math teacher’s self-efficacy in integrating technology and (TPACK). The study used a questionnaire containing (71) items, and the sample consisted of (66) national secondary math teachers. The results showed no gender or educational experience differences [4]. In Kenya, Mukenya, Martin and Shikuku (2020) investigated the knowledge and skills of math teachers to integrate ICT into secondary school education. The study used a questionnaire, and the sample consisted of (218) math teachers and heads of departments. The results indicated that teachers need more knowledge and skills to use ICT. They suggested that the Ministry of Education should work on policies to develop teachers’ ICT pedagogy and review the curriculum [5]. In Spain, the study of Gómez-García, Hossein-Mohand, Trujillo-Torres and Hossein-Mohand (2020) investigated the training and use of ICT in teaching mathematical concepts. The study used a questionnaire, and the sample consisted of (73) high school math teachers. The results showed differences in favor of teachers with less education experience and no gender differences [6]. Spangenberg and De Freitas (2019) in South Africa investigated the levels of (TPACK) and ICT integration barriers. The study used a quantitative questionnaire, and the sample consisted of (93) math teachers. The results showed poor technological content knowledge and suggested continuous professional development programs for teachers in specific ICT integration [7]. In Turkey, the study by Ozudogru and Ozudogru (2019) investigated math teachers’ technological pedagogical content knowledge. The study used a questionnaire containing (39) items, and the sample consisted of (202) math teachers. The technological knowledge section results showed significant differences in gender in favor of males and no differences in teaching experiences or school level [8]. In addition, the study of Birgin, Uzun and Akar (2020) investigated Turkish mathematicians’ perceptions of their proficiency in using ICT in teaching. The study used a descriptive survey; the sample consisted of (242) math teachers. The results showed that teachers’ knowledge of mathematical software is low, and there are no gender differences. However, there are differences in favor of teachers with less experience in education in terms of efficiency [9]. In China, Tan and Jiang (2021) aimed at the mathematical technological knowledge of elementary school math teachers. The study adopted the qualitative paradigm and a sample of (24) math teachers. The results showed that the teacher’s knowledge and use of technology classification are good. The previous research has yet to study the relationship between teachers’ knowledge and teachers’ training courses, academic qualifications, and teachers’ Internet access. Accordingly, this study will contribute to bridging this research gap.

Technological Mathematical Knowledge (TMK)

In 1986, Shulman came out with the (Pedagogical Content Knowledge) framework, which teachers need in terms of knowledge and tools to teach specific content. He considers educational technology a tool that facilitates teaching [11]. After the advent of E-learning and E-class design, Kohler and Mishra 2006 added technology as an independent regard of knowledge and not as a helping tool for teaching; (Technology knowledge) is the knowledge of technologies involving the skills of operating and using the old and new of them [12]. Also, they define the concept of (Technological Content Knowledge) as “an understanding of how teaching and learning can change when particular technologies are used in particular ways.” [13, p 65]. Thus, Schulman’s framework was expanded to (Technological Pedagogical Content Knowledge), which aims to demonstrate the necessary competencies for teachers to integrate technology with education [12]. Koehler and Mishra (2009) have embodied the framework in the “What is TPACK” study. The framework was a schematic illustrating the intersection of the three pieces of knowledge within the framework and the new knowledge resulting from its meeting with seven pieces of knowledge. As a result of the development of educational sciences and technologies, researchers [10,14,15] customized the content in the (TPACK) framework to include only mathematical content. [14] developed the Technological Pedagogical Mathematical Knowledge (TPMK) concept. [15, p 1] used the (Mathematical Technological Knowledge) concept, which they define as a “teacher’s knowledge of the technology developed as a result of exploring mathematics with technology”. This concept has an issue because some technologies are not just mathematical like an interactive whiteboard or Google apps. Similarly, [16, p 342] used the (Technological Mathematical Knowledge) concept, which they define as “the teacher’s knowledge of technological tools that can be used to represent mathematical knowledge”. However, [3, p 5] defines the broader concept of ICT-content knowledge as “knowing how to use ICT to represent, communicate, solve and explore mathematical contents, ideas, or problems without consideration of teaching approaches”. Taking advantage of these definitions, this paper defines (Technological Mathematical Knowledge) as knowledge of educational technologies hardware- and software along with how to use them to represent, explain, solve and explore mathematical content, ideas or issues regardless of the educational pedagogy, ” how to make a circle within a triangle using GeoGebra” [16, p 2].

Educational Technologies for Mathematics

Interactive Whiteboards

An interactive whiteboard is a versatile tool that allows teachers to deliver engaging lessons using various applications and educational programs [17]. Studies show it improves students’ math achievement [18]. And can benefit displaced learners in challenging environments.

Computer Algebra Systems: One of the most prominent software applications is GeoGebra. It can solve quadratic equations by graphing and accurately representing geometric transformations, statistical representation and data analysis, providing an interactive geometric environment for learners and representing shapes with a 3D environment; meanly, learning by GeoGebra improves the geometrical abilities of students [19]. In addition to its positive impact on achievement [20], it is also one of the best technological options that enriches the quality of research and mathematical conception from different perspectives that support feedback. It also provides strategies for teachers to teach according to students’ needs and facilitates learning through virtual representations that represent reality and focus on educational benefits [21]. Thus, the use of GeoGebra has a significant impact on mathematical abilities [22]. Another example is Sketchpad which combines geometry designs with algebra and calculus, curves representing descendants, then algebraic representation such as coordinates or equations and finally, a data table representation [23]. Sketchpad shares the advantage of learning through practice and developing the learner’s ability to use these applications with GeoGebra on smartphones [24].

Coding language: Scratch, for example, is a straightforward and exciting initial learning tool for understanding basic programming principles, creating educational and recreational content, building mathematical and scientific projects and simulating and visualizing experiments. Scratch not only allows learning math in an easy, effective and exciting way, but teachers also use it to teach basic mathematical principles of arithmetic and geometry [25]. In short, scratch is superior to other programming languages by attracting children to learn programming in the future [26].

Smartphone apps: are a form of distance learning and an extension of E-learning. Teachers can provide math content and follow learners anywhere, anytime by designing high-quality digital learning objects in math. Students can also learn mathematical content according to their circumstances and needs [27]. Moreover, the smartphone was the best technology for teachers during the COVID-19 pandemic [28]. It also supports applications such as Kahoot, a free educational program that supports many languages, such as Arabic, based on the play-and-response classroom system. It also helps students learn and self-evaluate, better demonstrate what they have learned, make math more exciting and vital and increase motivation to learn [29].

Online Tools: The field of education has been revolutionized by two powerful types of tools. The first type is the learning management system, such as MOODLE, an open-source program utilized in over 235 countries to support the E-learning process. Particularly effective in math education, MOODLE encourages learners to engage in cognitive thinking skills and fosters the generation of new ideas [30]. The second type is online learning resources, including Massive Open Online Courses (MOOCs), which cater to both teachers and students. These resources that are available through platforms like Coursera, Alison, Udemy and others, offer high-quality content in various specialties such as mathematics, computer science and languages. MOOCs have proven to be an invaluable resource, helping teachers enhance their professional knowledge and enabling students to access a wide range of courses, including specific mathematics courses [31], through platforms like Coursera, EdX and others. These platforms provide videos that can effectively supplement classroom learning, allowing teachers to explain complex concepts more easily.

The war in Syria had a significant impact on the education sector; it destroyed schools and displaced students, which led teachers to adopt unconventional education methods even before the COVID-19 pandemic, which was the first real challenge to educational technologies. According to McGonigal (2005) as cited in [32, p 49]“Teachers need an activating event to expose the limitations of their current knowledge”. So, what event is more challenging than war or a pandemic?

This phenomenon raises a controversial issue; did teachers have the knowledge and skills to help them cope with this crisis? And how did their knowledge and skills develop after the crisis? The current study aims to classify the technological mathematical understanding of Syria’s math teachers and the effects of demographic variables. Consequently, two questions and five related null hypotheses were formed for demographic variables, as follows:

• What is the classification of Syrian math teachers’ technological mathematical knowledge?
• Are there statistically significant differences in teachers’ technological mathematical knowledge according to gender, academic qualification, years of experience, training courses, and Internet access?

METHODS

Participants

The online survey was shared in a Facebook group for Syrian math teachers. The researcher used the approval of the Ethics Committee of the Ministry of Education. Data was collected in the second semester of the 2021-2022 academic year. The sample was limited to (219) teachers, as shown in Table 1.

Tools

The study used a questionnaire based on [3]. The validity of the study tool was confirmed using an independent T-test and the reliability was assessed with a Cronbach-Alpha coefficient value of 0.859. Its items were classified into two parts; the first included demographic information, including gender, academic qualification, years of experience, established courses and Internet access. Part two: aimed at Technological Mathematical Knowledge, consists of (3) items intended for knowledge of educational devices, (4) items aimed at general understanding of software, (4) items aimed at knowledge of computer mathematical software, (4) items aimed at knowledge of Smartphone tools, two items on knowledge of online tools, (7) items aimed at mathematical technology content knowledge at levels:( strongly disagree, disagree, neutral, agree, strongly agree)

Data Analysis

In this study, the researcher used SPSS for statistical analysis, including coding responses into a five-point scale, calculating averages and standard deviations, conducting T-tests for validity, gender, and internet access, applying Cronbach’s alpha for reliability, using ANOVA for comparing mean responses in the case of (Academic qualification, courses, and Years of experience), and performing Fisher’s LSD test. All hypotheses were tested at a significance level of α=0.05.

RESULTS

Technological Mathematical Knowledge (TMK) of Syrian Math Teachers

Table (2) shows that the mean score of teachers’ knowledge of hardware was (3.37), which is higher than the average. In addition, their mobile knowledge was higher than their computer and interactive whiteboard knowledge, and the mean score of teachers’ knowledge of general software was (3.14), and the table shows that knowledge of Microsoft applications was the highest with average (3.92), the average knowledge of mathematical software was (2.53) which is below average, dynamic applications such as GeoGebra appear as the highest mean (2.84), the mean score of mobile tools was (3.47), which is higher than the average, and social media apps show the highest mean score (3.84), the mean score of online tools was (2.70), but the mean score of using mathematical technology was (2.30), which is below the average, and the highest field of use was in geometry with an average of 2.41.

The Effects of Demographic Variables on Technological Mathematical Knowledge.

Gender differences in teachers’ (TMK)

Table 3 shows the results of an independent sample t-test comparing the means of teachers’ technological mathematical knowledge based on gender. The table shows that the mean score for male teachers is 3.13 and the mean score for female teachers is 2.75, the t-value is 3.922. A higher t-value indicates a larger difference between the means, the significance level of less than 0.05 is typically considered statistically significant. In this case, the significance level is 0.000, which is less than 0.05. Based on the t-test results, we can reject the null hypothesis that there is no difference between the means of technological mathematical knowledge scores for male and female teachers. So, there is a statistically significant difference between the means, with male teachers scoring higher on average than female teachers.

Academic qualification differences in teachers’ (TMK)

The results of the one-way ANOVA analysis in Table 4 indicate a statistically significant difference (p < 0.05) in technological Mathematical Knowledge scores between teachers with different academic qualifications. This means that we can reject the null hypothesis that there is no difference in scores between the groups.

Further analysis using the LSD test in Table 5 helps pinpoint which specific groups differ from each other. The LSD test reveals significant differences in technological proficiency scores between the following groups:

• Diploma and bachelor’s degree holders (average difference: -0.25268 & Sig = 0.193)
• Diploma and master’s degree holders (average difference: -0.5207 & Sig = 0.015)
• Master’s and bachelor’s degree holders (average difference: 0.2680 & Sig = 0.028)

the researcher concludes that there are statistically significant differences in teachers’ (TMK) based on academic qualification in favor of the master’s degree group. At the same time, there were no differences between the bachelor and diploma groups.

Training courses differences in teachers’ (TMK)

The results of the one-way ANOVA analysis in Table 6 indicate a statistically significant difference (p < 0.05) in Technological Mathematical Knowledge scores between teachers with different training courses. This means that we can reject the null hypothesis.

The LSD test in Table 7 reveals significant differences in technological proficiency scores between the following groups:

• No Courses and Technology Integration Courses (average difference: -0.09665& Sig = 0.370)
• No Courses and MOOCs (average difference: -0.50209& Sig =0.001)
• Technology Integration Courses and MOOCs (average difference: -0.40554& Sig = 0.006)

the researcher concludes that there are statistically significant differences in teachers’ (TMK) based on Training courses in favor of the MOOCs group. At the same time, there were no differences between the No Courses and Technology Integration Courses groups.

Years of experience differences in teachers’ (TMK)

The results of the one-way ANOVA analysis in Table 8 indicate a statistically significant difference (p < 0.05) in Technological Mathematical Knowledge scores between teachers with different Years of experience. This means that we can reject the null hypothesis.

The LSD test in Table 9 reveals significant differences in technological proficiency scores between the following groups:

• 1-7 years and 8-14 years (average difference: 0.48341& Sig = 0.007)
• 1-7 years and 15 years and more (average difference: 0.39751& Sig = 0.002)
• 8-14 years and 15 years and more (average difference: -0.68713& Sig = 0.280)

The researcher concludes that there are statistically significant differences in teachers’ (TMK) based on Years of experience in favor of the 1-7 years group. At the same time, there were no differences between the -14 years and 15 years and more groups.

Internet access differences in teachers’ (TMK)

Table 10 shows the results of an independent samples t-test comparing the means of teachers’ technological mathematical knowledge based on Internet access. The mean score for 3G/4G Network is 2.43 the mean score for ADSL Network is 3.85, t-value is 3.734 & (p = 0.000 < 0.05). Based on the t-test results, we can reject the null hypothesis. So, there is a statistically significant difference between the means in favor of the ADSL Network.

DISCUSSION

Results of the study showed that the general knowledge about devices was slightly above average and that a higher percentage of math teachers used smartphones because it is easy to use and widely available among learners in WhatsApp and Facebook groups as indicated in [9]. This result contradicts [3], where the highest percentage was computers. However, the researcher added an interactive whiteboard instead of the graphing calculator in our study. Our study indicates that Syrian math teachers’ general software knowledge ranked slightly above average. The highest percentage was Microsoft applications because it is familiar and easy to use and its training courses are easily accessible (ICDL). In this section, our findings are consistent with the results of [3, 9, 5], and add a section for smartphone applications, consistent with [33] in the excellent degree of using the WhatsApp application. Within the knowledge of mathematical software, the highest percentage was for GeoGebra. The reason might be to support the Arabic language and for its easy-to-use qualities. Besides, smartphone applications were more elevated than computer applications. As for Internet tools, knowledge of learning resources such as Coursera was higher than knowledge of learning management systems. This result contradicts [3] during a pre-COVID-19. This difference indicates that teachers use smartphones directly as an educational tool or a learning resource in times of crisis. The results showed poor use of mathematical technologies; a possible explanation might be that teachers are not well qualified for these technologies and not good enough at English. Another possible explanation is that most educational technological devices are unavailable in schools because the Ministry does not provide schools with such devices, which may be due to their high cost and the difficulty of producing them locally, along with the circumstances of war. This conclusion supports [5], which linked poor knowledge and use to the unavailability of technologies and devices in schools. On the other hand, [10] ranked the expertise and use of technology by Chinese math teachers as good and the integration of technology with education as excellent, owing to the availability of devices in Chinese schools.

Gender: There were significant differences in teachers’ (TMK) based on gender in favor of the male group, and this might be due to female teachers being busy with their household duties, so they do not have time to learn or use modern technological skills, unlike male teachers who have time to learn and use new technologies. This conclusion supports [8], which explains that male students tend to be more technological than female students who want to study languages and social sciences. This result is contrary to [9, 34, 6] where they showed no gender differences.

Academic qualification: There were significant differences in teachers’ (TMK) based on academic qualification in favor of the master’s degree group; a possible explanation is that master’s degree holders have excellent English and research skills. Besides, a good relationship with the Internet and all the new technologies in their specialties. As Patalinghug and Arnado [35, p 585] have pointed out “It would be a good practice for teachers to pursue advanced degrees like master’s degrees or even higher degrees” unlike the teachers who stopped at the bachelor’s or diploma, as they do not require development or scientific research. He satisfied himself with his job as a middle or secondary teacher, which does not require technical skills in our schools, [36] recommended a bachelor’s degree program should be redefined with smart technologies so students can learn fast and subjectively. Teachers might also need more time to master new technology. As [37, p 9] has mentioned, “Teachers may also feel that they do not have the time to learn new technologies because there have been many changes to middle and high school math courses and curriculum over the past several years”.

Training courses: There were significant differences in teachers’ (TMK) based on training courses in favor of the MOOCs group. This result might be because mathematical technologies are still new; therefore, they need advanced techniques that are not available in the ministerial integration courses. Logically this result supports the impact of MOOCs on teachers’ professional development and technological skills, as the studies of [38, 39] have indicated. In the USA, researchers have tested MOOCs as a teacher training course that provides content-focused experiences using technology. Expert trainers successfully designed exciting experiences for teachers that positively affected their perspectives, practices and beliefs in math teaching and statistics [39]. MOOCs worldwide allow teachers to forge partnerships and create learning communities that improve their professional knowledge and skills [40].

Years of experience: There were significant differences in teachers’ (TMK) based on years of experience in favor of the ‘1-7 years’ group. These teachers started their careers in the harshest circumstances of the war and then the COVID-19 pandemic. So, this shows that they were more resilient to learning modern technologies that helped them overcome these conditions. This result is consistent with [6], which explains that teachers with less education experience have better training in ICT and use it broadly. However, this result contradicts [8, 34], where they showed no years of experience differences.

Internet access: There were significant differences in teachers’ technological mathematical knowledge based on Internet access in favor of (ADSL); a possible explanation is that (ADSL) is more stable and cheaper in developing countries like Syria. Therefore, it allows teachers to comfortably explore the Internet, enroll in any course, such as a course on Coursera, and watch a large number of instructional videos on YouTube, unlike the limited access (3G/4G).

CONCLUSION AND RECOMMENDATIONS

The present research aimed to classify the technological mathematical knowledge of Syrian math teachers. The results showed that its classification is below average, with the highest percentage of smartphones and their mathematical applications. In the face of unprecedented challenges like war and pandemics, teachers must remain committed to developing themselves and their skills. Our research reveals a powerful tool for overcoming these obstacles: a strong relationship with the internet. By leveraging the vast resources available online, teachers can advance their mathematical and technological knowledge and equip themselves to better serve their students. This is a critical time for educators to embrace the power of technology and chart a path forward to a brighter future. This paper suggests that Ministries of Education develop comprehensive teacher training programs to prepare teachers for crises like war or pandemics. These programs should focus on developing teachers’ skills in modern mathematical software tools, mathematical applications, social media platforms, distance learning platforms, interactive lessons and E-testing. They can be extended to cover other educational subjects and mathematical technologies should be introduced to build the technological mathematical knowledge of graduates. Finally, teachers’ access to the Internet must be supported. These measures will ensure quality education during crises.

 

INTRODUCTION

Asphalt concrete mixture consists of coarse aggregates, fine aggregates, filler and asphalt binder. It is a sensitive material compared to other materials used in civil engineering and exposed to many factors that undermine its strength such as moisture, repetitive traffic loading, ageing and fatigue ^(1,2). Therefore, researches are trying to improve the performance of asphalt pavements through their reinforcement with different types of fibers. The addition of fibers to asphalt improves material strength as well as fatigue characteristics and ductility ⁽³⁾. Fig. 1 shows the performance of the fibers in asphalt concrete (AC). As a truck stops, the fibers spread the force throughout the treated layer, reducing stress and fatigue where the tires meet the road ⁽⁴⁾.

Previous studies of reinforced asphalt concrete have focused on different types of fiber such as polypropylene, polyester, carbon and glass ^(5-8). Polypropylene fibers provide three-dimensional reinforcement of the concrete, making it tougher and more durable ^(9,10). The common forms of these fibers are smooth-monofilament and have triangular shape. Polypropylene fibers are widely used as reinforcing agents in rigid and asphalt pavement ^(11,12). Othman (2010) investigated the effect of polypropylene application method on long-term aging of hot mix asphalt (HMA). Three different polypropylene application methods were prepared for that purpose and a constant polypropylene content of 0.7% by weight of the total mix was adapted. The first mixture was prepared using polypropylene coated aggregate. The second mixture was prepared using the traditional wet process method, where polypropylene is blended with asphalt binder at high temperature. The third mixture was prepared using the dry method where polypropylene powder was added to the mineral aggregate prior to mixing it with asphalt. Testing procedures included the Marshall tests for aged and unaged mixtures, indirect tensile strength, fracture energy, and unconfined compressive strength. This paper concluded that the inclusion of polypropylene has significantly improved indirect tensile strength, fracture energy, and unconfined compressive strength. It was also concluded that samples prepared using polypropylene coating methods displayed the highest tensile strength and fracture energy under aged and unaged conditions ⁽¹³⁾. Tapkın et al.  (2009) concluded that the most suitable polypropylene fibers can be used at a dosage of 0.3% by weight of the aggregates and increased the Marshall stability values by 20% and the life of the Polypropylene fibers modified asphalt specimens under repeated creep loading at different loading patterns by 5–12 times versus control specimens. It also indicated that the addition of polypropylene fibers improves the behavior of the specimens by increasing the life of samples under repeated creep testing ⁽¹⁴⁾. Ahmad et al. (2015) studied the behavior of Polypropylene fibers reinforced asphalt mixtures on fatigue performance. The results from this study show that the addition of polypropylene fibers improves the behavior of the specimens by increasing the life of samples under fatigue testing according to the test results, the addition of 1.5 % of polypropylene fibers prolongs the fatigue life by 113 % in terms of number of cycles, in comparison to plain asphalt concrete beam ⁽¹⁵⁾. Zachariah et al. (2018) evaluated the effect of Polypropylene fibers reinforcement on bituminous concrete using brick as aggregates (first class brick and over burnt bricks). Resilient modulus tests, moisture susceptibility test, creep tests and indirect tensile strength test were performed. The Marshall test and basic property tests were used to justify the performance of polypropylene modified bituminous mixes using bricks as aggregates. This study concluded that brick aggregates can be used in asphalt concrete for using as a surface course if asphalt is modified with polypropylene fibers, and the optimum polypropylene fibers content was found to be 2% of aggregate by weight for first class bricks (where resilient modulus increased by 162%) and 4% of aggregate by weight for over burnt bricks (where resilient modulus increased by 157%). The results indicated that polypropylene fibers addition enhances the characteristics of asphalt, helps in reducing the temperature susceptibility of the mix, and fulfills the minimum requirement of tensile strength ratio TSR ⁽¹⁶⁾. Li et al.  (2024) analyzed the viscoelastic characteristics of asphalt binders reinforced with polypropylene fibers by using dynamic shear rheological (DSR) testing. The binders reinforced with fiber showed superior resistance to high temperatures and long-term deformation while being less sensitive to temperature and having a more significant elastic characterization ⁽¹⁷⁾. Whereas Jalota et al. (2023) improved the moisture resistance of flexible pavements by using polypropylene fibers measuring 6 mm in length and different dosages of liquid anti-stripping agents ⁽¹⁸⁾. Other researches evaluated the influence of polypropylene fiber on concrete and rigid pavements ^(19,20), while other studies focused on hybrid reinforcement to improving performance of asphalt concrete mixtures through their reinforcement with two or more types of fibers such as: polypropylene and glass fibers ^(21,22), polyester and polypropylene fibers ⁽²³⁾, glass and carbon Fibers ⁽²⁴⁾, polyolefin and aramid fibers ⁽²⁵⁾ and Hybrid Fiber and Nano ⁽²⁶⁾.

MATERIAL AND METHODS

Asphalt binder

The Asphalt used in this study was a 60/70 penetration grade obtained from Homs Refinery Company. The Physical Characteristics of the Asphalt binder were tested according to standard specifications and are listed in Table 1. Aggregates

The coarse and fine aggregates were supplied from Hsia City. The gradation of the test specimens was performed in accordance with ASTM of surface course, Table 2 and Fig. 2 show the gradation of these aggregates. They were selected and incorporated in preparing all hot asphalt concrete mixes used in this study. The mechanical and physical characteristics of used aggregates have been tabulated in Table 3.

Fibers

Polypropylene fibers were selected to reinforce asphalt concrete mixtures. Some of the specifications of the polypropylene fibers used in this study are shown in table 4.

Experimental Methods

Polypropylene fibers were used in asphalt mixtures with different percentages (3, 4, 5 and 6%) by weight of the asphalt binder. polypropylene fibers were added to hot asphalt binder and mixed manually for five minutes (until the mix acquires uniformity). Then, the modified asphalt was mixed with aggregates. To determine the optimum asphalt content that would produce asphalt concrete mixtures, 15 samples were tested according to The Marshall test (ASTM.D 1559). The Marshall method is used for all mixtures. The optimum asphalt content was selected from figure. 3 as the average of the asphalt content for maximum density, maximum stability and 4% air voids. The optimum binder content was found to be 5% by weight of the total mix. All PPF modified specimens were prepared using constant asphalt binder content (5%) and produced at a mixing temperature of 160ºC.

RESULTS

Effect of Polypropylene fibers on the performance of the asphalt binder

To determine the effect of Polypropylene fibers on the physical characteristics of the asphalt, penetration, softening point, and ductility tests were carried out on both reinforced and unreinforced asphalt binder with PPF. The penetration value determines the hardness of asphalt by measuring the depth (in tenths of a millimeter) to which a standard and loaded needle will vertically penetrate in 5 seconds a sample of asphalt maintained at a temperature of 25°C (ASTM D 5). The results of the penetration test are presented in Fig. 4.

Ductility is the property of asphalt that permits it to undergo great deformation or elongation. It is defined as the distance in cm, to which a standard sample or briquette of the material will be elongated without breaking (ASTM D 113). Fig. 5 shows the change in the ductility of asphalt binder depending on the Polypropylene fiber content. As the Polypropylene content increases, the ductility values decrease.

The softening point is determined as the temperature at which a sample of asphalt, subjected to a progressive increase in temperature and the weight of a steel sphere, reaches a consistence that leads to its flow through a ring of steel, until a specific deformation is obtained (ASTM D 36). The results of the softening point test are presented in Fig. 6.

Evaluation of polypropylene fibers addition on asphalt mixtures characteristics

At this stage, 45 Marshall specimens are prepared using asphalt binder content (5%). The Marshall test results for reinforced and unreinforced asphalt mixtures are tabulated in Table 5.

Fig. 8 indicates that as the Polypropylene fibers content increases, the Marshall flow for asphalt mixtures decreases.

Fig. 9 presents the results of air voids percentage in the total mix for all mixtures. It indicates that polypropylene fibers have increased the air void percentage in all the specimens.

DISCUSSION

The penetration results indicate that the consistency of the PPF reinforced asphalt decreases as the PPF content in the mix increases. The reduction in penetration values were (29%, 38%, 51% and 62%) with the addition of (3%, 4%, 5% and 6%) of PPF, respectively, as compared to the unreinforced asphalt. This means that the addition of PPF makes the asphalt harder and more consistent. These results indicate that the rutting resistance of the mix is improved, but on the other hand, the high stiffness makes the asphalt concrete less resistant to fatigue cracking. It was also found in this research that the ductility values decreased as the addition percentage increased. This could be due to the position of polypropylene fibers in the cross-section of the asphalt binder during the ductility test, which prevents the asphalt from stretching easily. By increasing the Polypropylene fibers content, the softening point increased. This increase ranges from 16% to 36% with the addition of 3% to 6% of PPF content, this result indicates that the resistance of the reinforced asphalt binder to high temperatures is increased. Consequently, the results of the asphalt binder tests indicate that the reinforced asphalt samples with PPF are much stiffer and more resistant to high temperatures and rutting. The results of the Marshall tests indicate that the increasing in the polypropylene fibers content led to an increase in Marshall stability and decrease in flow values for asphalt mixtures. Increasing of 12%, 14%, 22% and 28% in stability values with the addition of 3%, 4%, 5% and 6% of PPF, respectively, to comparing with the traditional asphalt mixtures. Polypropylene fibers led to increase the air voids in all reinforced mixtures. This could have occurred because all the specimens were prepared 5% asphalt content, therefore, PPF added samples need more asphalt traditional specimens. However, the air voids of reinforced mixtures with Polypropylene fibers  up to 5% content were acceptable as compared with the specification limits (3-5%) [ASTM].

CONCLUSIONS

Based on the results of studying the effect of polypropylene fibers in asphalt concrete mixtures, it can be deduced:

1. The laboratory tests of asphalt binder showed that polypropylene fibers change the characteristics of original asphalt binders such as decreasing penetration at 25 °C, decreasing ductility and increasing softening points with the increasing of polypropylene fibers content. These results indicate that PPF reinforced asphalt can improve the characteristics of asphalt concrete against deformation, and we recommend to use it in high temperature areas.
2. The results of the Marshall tests indicated that the addition of PPF led to increase the stability value and air voids content, while the flow values decreased.
3.  The recommended proportion of the polypropylene fibers (PPF) is 5% by weight of the asphalt binder.

RECOMMENDATIONS

1. Study of the microstructure of the asphalt binder and mixture using Scanning Electron Microscopy (SEM).
2. Study the behavior of polypropylene fiber reinforced asphalt mixtures on fatigue performance.
3. Investigate the effect of other fibers (glass and carbon fibers) on the characteristics of asphalt binder and HMA mixtures.

INTRODUCTION

Vascular Endothelial Growth Factor (VEGF) is a homodimeric glycoprotein with a molecular weight of approximately 28 KD. This protein serves as a critical mediator for angiogenesis, the formation of new blood vessels. VEGF exerts its physiological effects by binding to two receptors known as Flt-1 (VEGFR-I) and KDR (VEGFR-II) (1). These receptors possess seven extracellular immunoglobulin-like domains and one intracellular tyrosine kinase domain. They are expressed on the surface of endothelial cells, playing a critical role in the regulation of angiogenesis (2, 3). Under hypoxic conditions, the expression of VEGF receptors increases, leading to the induction of the angiogenesis phenomenon. The binding of VEGF to the VEGFR-II receptor stimulates the response of endothelial cells in blood vessels (4-6).  Although VEGFR-I has a higher affinity for this factor, it only plays a role in sequestering VEGF and facilitates its access to the VEGFR-II receptor, which is the primary receptor mediating antigenic signaling. VEGF binds to these receptors through two distinct domains (7, 8). In healthy individuals, VEGF contributes to angiogenesis during embryonic development and plays a critical role in adult wound healing. Pathological angiogenesis is pivotal in various conditions such as tumor growth, metastasis, diabetic retinopathy, macular degeneration, rheumatoid arthritis, and psoriasis (9-11). Inhibition of angiogenesis can be achieved by several methods, including inhibition of endothelial cell signal transduction, migration, and survival, as well as modulation of factors such as growth, proliferation, matrix metalloproteinase, and bone marrow precursor cells. VEGF, as a regulator of tumor angiogenesis, exerts its angiogenic effects by binding to its receptors, especially VEGFR-II, thereby influencing the mentioned processes (12-14). Therefore, this molecule is of great importance as a valuable drug target in antiangiogenic therapies (12, 15). Single-domain antibodies, nanobodies, or VHHs possess valuable characteristics, including effective tissue penetration, high stability, and ease of humanization, efficient expression in prokaryotic hosts, and specificity and affinity for their respective antigens. Consequently, they can be introduced as alternative therapeutic candidates to traditional antibodies. VHHs represent the smallest functional unit of an antibody, preserving all of its functions, and due to their minimal size, they are also recognized as nanobodies (16-18). The studies conducted by Shahngahian and colleagues in 2015 demonstrated that VEvhh₁₀ (accession code LC010469) exhibits a potent inhibitory effect on the binding of VEGF to its receptor (19). The mentioned VHH exerts its inhibitory role by binding to the VEGF receptor binding site. VEvhh₁₀ also possesses the highest binding energy at the VEGF receptor binding site among other members of the VHH phage display library, covering vital amino acids involved in the biological activity of VEGF and disrupting its biological function. A standard method for expressing non-fused VHH is the use of E. coli expression systems. However, expressing non-fused VHH using conventional cytoplasmic expression methods in this prokaryotic host often leads to the formation of inclusion bodies (20, 21). In this study, to overcome this issue, a surface display technique was chosen, allowing peptides to be presented on the surface of microbial cells through fusion with anchoring motifs. The ice nucleation protein (INP) is one of the joint membrane proteins in bacteria (22-27). Despite the size limitations that most surface expression systems have regarding the display of target proteins on the cell surface, an INP-based surface expression system can express and display VHH on the bacterial surface, and overcoming the problems of cytoplasmic expression within bacteria.

MATERIALS AND METHODS

Molecular and Chemical Materials

The materials, chemicals, and reagents required for the lab are listed as follows:

• Ampicillin and Agarose from Acros (Taiwan)
• IPTG from SinaClon (Iran)
• Ni-NTA resin from Qiagen (Netherlands)
• Plasmid extraction kit and gel extraction kit from GeneAll (South Korea)
• Enzyme purification kit from Yektatajhiz (Iran)
• Restriction enzymes HindIII/XhoI, ligase enzyme, and other molecular enzymes from Fermentas (USA).
• pfu polymerase and Taq polymerase from Vivantis (South Korea)
• Primers from Sinagen (Iran)
• Methylthiazole-tetrazolium (MTT) powder from Sigma (USA)
• Penicillin-Streptomycin, Trypsin-EDTA, and DMED-low glucose from Bio-Idea (Iran)
• Fetal Bovine Serum (FBS) from GibcoBRL (USA)
• A monoclonal conjugated anti-human antibody with HRP from Pishgaman Teb (Iran)
• Anti-Austen antibody from Roche (Switzerland)
• Other chemicals from Merck (Germany)

Design of fusion genes and constructions of pET-INP-VHH

Gene Cloning: Primers for the amplification of the VEvhh₁₀ gene with the accession code LC010469 were initially designed (Table 1). The plasmid containing the gene fragment served as a template for the Polymerase Chain Reaction (PCR). Amplification was carried out using Taq polymerase and Pfu polymerase enzymes in a thermocycler with a programmed temperature profile (Table 2). Various annealing temperatures for primer binding to the template were tested, and a temperature of 65°C was found to be the optimal annealing temperature. Primer cutting sites at the beginning and end of the Gene were designed, and the location of the TEV protease enzyme cutting site was positioned between the INP linker and the VEvhh₁₀ sequence.

The VEvhh₁₀ gene fragment, amplified by the pfu polymerase through PCR, was extracted from the gel. Simultaneously, digestion of this fragment and the pET-21a vector containing the INP linker was carried out using the HindIII and XhoI restriction enzymes. Purification was performed using a commercial enzyme purification kit. Ligation of the gene fragment into the target vector was accomplished using the T4 DNA ligase enzyme. The resulting product was incubated at 4°C overnight. The ligated product was then transferred into E. coli DH-5α bacteria. To confirm the Gene insertion into the vector, the transformed bacteria were plated on antibiotic- ampicillin containing plates. The obtained colonies were then subjected to Colony PCR using specific primers for VHH, T7 promoter, and terminator primers. The PCR products were analyzed on a 1% agarose gel, and positive transformants were screened and cultured. The recombinant plasmid was purified using a plasmid extraction kit. Enzymatic dual digestion by HindIII and XhoI was performed to confirm the insertion of the gene fragment into the plasmid.

Expression and detection of the Gene constructs InaK-N_TEV Protease

 The gene structure of the InaK-N_TEV Protease was transformed in the pET-21a plasmid containing INP and VHH using a heat shock method in the E. coli BL21 (DE3) host. For protein expression, a colony from bacteria harboring the recombinant plasmid was inoculated into 10 mL LB medium supplemented with 100 mg/ml ampicillin and incubated at 37 °C with adequate aeration (250 rpm). Subsequently, 1 mL of the grown bacteria was transferred to 50 mL LB medium containing ampicillin and incubated at 37 °C until the OD₆₀₀ reached approximately 0.6. Finally, expression was induced with 1 mM IPTG for 24 hours at 25 °C. The resulting product was centrifuged at 4000 rpm for 15 minutes, and the obtained pellet was stored at -20 °C until further analysis. To confirm protein expression, SDS-PAGE (Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis) was performed using a 12% acrylamide gel under non-reducing conditions according to the Laemmli method (28).

The expression and purification of VEGF_8-109

The pET-28a plasmid containing the VEGF_8-109 gene (the domain binding to the VEGF receptor) was transformed into E. coli BL21 (DE3) bacterial cells and cultured at 37 °C overnight in Terrific Broth (TB) medium supplemented with 100 mg/ml kanamycin. Subsequently, induction was carried out with 0.5 mM IPTG at an OD₆₀₀ of 0.6, and the cells were incubated at 24 °C for 22 hours (29). After centrifugation (5000 g, 15 minutes, 4 °C), the bacterial cells were sonicated in a lysis buffer containing 50 mM NaH₂PO₄, 300 mM NaCl, 10 mM imidazole, and 1 mM PMSF (pH 8.0). The sonication product was further centrifuged at 12000 rpm for 20 minutes at 4 °C. The resulting supernatant was analyzed using SDS-PAGE for further characterization (30). Protein purification was carried out using affinity chromatography with a nickel column. For this purpose, the protein sample was transferred onto a column that had previously reached equilibrium by washing with a wash buffer (Tris-base (50 mM, pH 8.0) + NaCl (300 mM) + Imidazole (20 mM)). At this stage, proteins lacking a histidine tag were washed out and removed from the column using this buffer. Only the target protein, due to the presence of a histidine tag, remained bound to the column. Subsequently, using the elution buffer (Tris-base (50 mM, pH 8.0) + NaCl (300 mM) + Imidazole (250 mM)) in the presence of a high concentration of imidazole, protein separation was performed. Additionally, purification was conducted using cold buffers to prevent the thermal denaturation of proteins. Following that, dialysis was performed in PBS buffer containing glycerol overnight at 4 °C, and the protein was analyzed using SDS-PAGE. Protein concentration was determined by the Bradford method with BSA as a protein standard (31).

Cell Culture

Human Umbilical Vein Endothelial Cells (HUVEC) were cultured in T25 flasks using Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5 mM glucose, 2 mM L-glutamine, 10% fetal bovine serum (FBS), 1% penicillin (100 mg/mL), and streptomycin (100 mg/mL). The cells were maintained at 37°C with 5% CO2 and used for subsequent experiments (32).

In vitro endothelial cell proliferation assay

In order to investigate the effect of VEGF_8-109 on the growth and proliferation of HUVECs, the MTT colorimetric method was employed (33). A total of 5×10³ cells were seeded in each well of a 96-well culture plate. After cell attachment within 24 hours, the culture medium was replaced with fresh medium containing VEGF_8-109-RBD protein at various concentrations (10, 30, 60, 120, and 240 ng /mL), and the cells were incubated at 37 °C for 48 hours. Three independent assessments were performed for each treatment. For cell proliferation determination, cells were treated with 0.5 mg/mL MTT for 4 hours at 37 °C, and then the medium was carefully removed. Formazan crystals were dissolved in 100 μL of DMSO, and the absorbance was read at 570 nm using a µQuant plate reader from BioTek (USA).

ELISA-based immunoassay

The surface-expressed VHH-expressing bacterial cells, using the INP anchor, were prepared in a carbonate-bicarbonate buffer (pH 9.6, 0.1 M Na₂CO₃, 0.1 M NaHCO₃). Subsequently, 100 μL of bacterial cells containing the INP-VEvhh₁₀ linker were added to each well and incubated at room temperature for 16 hours. After 16 hours, the solution was aspirated, and the wells were washed three times with 100 μL of PBS buffer. Blocking was performed using a blocking buffer consisting of 2% gelatin in PBS (350 μL) for one hour at 37 °C. The blocking solution was then aspirated, and the wells were washed three times with 100 μL of PBST buffer (PBS + 0.05% Tween-20). Serial dilutions of VEGF solutions (ranging from 5.0 ng/mL to 500 ng/mL) were added to the wells and incubated for 2 hours at room temperature. After incubation, all wells were aspirated and washed thoroughly with PBST buffer. Subsequently, 100 μL of human monoclonal anti-VEGF antibody at a concentration of 1000 ng/mL was added to each well, followed by incubation in the dark at 37 °C for 1.5 hours. Then, 100 μL of Anti-Human IgG conjugated with HRP were added to each well and incubated in the dark at 37 °C for 1.5 hours. Finally, 100 μL of TMB and H₂O₂ were added to each well and incubated for 15 minutes in the dark. The reaction was stopped by adding 100 μL of 2 N sulfuric acid to each well. The absorbance of the wells was then read at 450 nm wavelength.

RESULTS

Construction of pET-21a-Ina_K537-TEV-VEvhh₁₀ expression plasmid

A schematic representation of the gene structure pET-21a-Ina_K537-TEV-VEvhh₁₀ is presented in (Figure 1) using Snapgene.v5.1.5 software. Initially, the plasmid pComb3X containing the VEvhh₁₀ gene sequence with the accession number LC010469 in the GenBank database was registered and extracted from E. coli TG bacteria using the Gene All kit. Subsequently, the plasmid served as a template for VEvhh₁₀ gene amplification using specific primers for the VEvhh₁₀ gene (414bp), Taq DNA polymerase (Figure 2a), and pfu polymerase (Figure 2b). After the amplification process, the PCR product (VEvhh10) was digested with HindIII and XhoI enzymes to create cohesive ends, It has been cleaned (402bp) (Figure 2c). Additionally, the pET-21a vector containing the INP linker was linearized through digestion with HindIII and XhoI restriction enzymes for subsequent pure attachment, the results of this stage were as expected in terms of nucleotide sequence counts.

After ligation, the resulting product (pET-21a-Ina -TEV-VEvhh10) was incubated at 4℃ for 14 h and then introduced into bacteria. The transformed product was cultured on ampicillin-containing LB plates. Positive samples were isolated and confirmed for gene insertion using colony PCR. Subsequently, the extracted pET-21a-Ina_K537-TEV-VEvhh₁₀ plasmid was used as a template for amplifying the VEvhh₁₀ gene and the gene structure containing INP. The PCR was performed on the plasmid extraction using Forward and Reverse primers for the VEvhh₁₀ gene 414bp as shown (Figure 3a) and, likewise, Forward and Reverse primers for the T7 promoter and terminator of the plasmid 1099bp as shown (Figure 3b). The plasmid was digested with HindIII and XhoI enzymes, resulting in the visualization of the target gene on the gel (Figure 3c). After examination, the results indicated the success and confirmation of the cloning.

Confirmation of Surface Expression Ina_K537-TEV-VEvhh₁₀

The InaK-N_TEV Protease_Cleavage_Site_VEvhh₁₀ structure consists of three parts: the initial 537 bp of the InaK gene from Pseudomonas syringae encoding a protein with an approximate molecular weight of 19-KD, the VEvhh₁₀ mono body gene with 372 bp and a protein with an approximate molecular weight of 14 KD, and the coding sequence for the TEV protease cleavage site with 21bp. Therefore, the molecular weight of the unmodified InaK-N_TEV Protease_Cleavage_Site_VEvhh₁₀ structure is around 33 KD. To investigate the surface expression of VHH, bacterial pellets were divided into three parts after expression. The first part underwent sonication, the second part was digested with lysozyme, and the third part remained as intact cells (Figure 4). Each of these fractions was also treated with the TEV protease, and the results obtained in SDS-PAGE non-denaturing gel are shown (Figure 4). The appearance of a band in the 33-KD range in SDS-PAGE for the lysed bacterial pellet induced with IPTG, in comparison to the control sample, indicates the expression of this protein. Bands in lanes 1, 3, and 5 represent the expressed surface protein in the presence of TEV protease, indicating a weak TEV protease band and an additional 19-KD band corresponding to INP. In contrast, lanes 2, 4, and 6 show bands corresponding to the expressed surface protein in the absence of TEV protease, and these bands are stronger compared to the previous condition. Additionally, due to the lack of cleavage by TEV protease, the band corresponding to INP did not appear. These results indicate the successful surface expression of VEvhh₁₀ (Figure 5).

In vitro HUVECs proliferation assay

Before investigating the binding capability of the expressed VHH on the bacterial surface, the activity of the produced non-fused VEGF_8-109 was assessed by its effect on the growth and proliferation of human umbilical vein endothelial cells (HUVECs) using the MTT assay. As illustrated in Figure 6, cell proliferation is well-performed with an increase in the concentration of non-fused VEGF_8-109. At a concentration of 240 ng/mL, the cell population has reached approximately 80% compared to the sample lacking VEGF_8-109. Therefore, the produced non-fused VEGF exhibits biological activity and can be utilized in VHH binding assays.

Evaluation of binding of VHHs of VEGF

In order to assess the binding capability of VEvhh₁₀ to VEGF, an ELISA-based immune assay was employed following the mentioned method (Figure 7a). The results obtained from the dose-response curve of VEvhh₁₀ expressed on the bacterial surface using the ELISA method (Figure 7b) demonstrated that an increase in VEGF concentration led to a higher number of anti-VEGF molecules binding to it, resulting in an enhanced optical absorption.

DISCUSSION

According to global statistics, cancer is one of the problems that the world community is facing (34). One promising approach is to inhibit angiogenesis, the formation of new blood vessels, which tumors rely on for growth. Tumor cells can undergo cell death due to oxygen and nutrient deficiency if new vascular systems do not develop. However, when the vascular system extends towards the tumor, it can continue growing. Since angiogenesis is a common requirement across many cancers, targeting it is an effective strategy for tumor elimination. Tumor cells promote vascular growth by secreting VEGF, which affects endothelial cells, triggers signaling cascades, and increases cell proliferation, migration, and survival (35, 36).Vascular endothelial growth factor (VEGF) is the key inducer of angiogenesis, which is crucial for tumor growth and metastasis. Under pathological conditions, VEGF expression significantly increases, with 60% of cancer cells upregulating VEGF to facilitate growth. VEGF promotes endothelial cell proliferation and migration, and increases vascular permeability and protease expression, aiding angiogenesis (10). Due to its pivotal role, VEGF is a primary therapeutic target. Inhibiting VEGF involves strategies like monoclonal antibodies, VEGF mutants, receptor antagonists, soluble receptors, tyrosine kinase inhibitors, anti-sense methods, and aptamers. VEGF functions by binding to its tyrosine kinase receptors (VEGFR-I and VEGFR-II), leading to receptor dimerization and phosphorylation (5). In recent years, targeted therapy using monoclonal antibodies has gained significant attention and emerged as one of the most successful strategies for treating hematologic malignancies and solid tumors. Monoclonal antibodies eliminate tumor cells through various mechanisms, including direct impacts on tumor cells (e.g., blocking receptors), immune system-mediated cell-killing, and specific impacts on tumor angiogenesis (37). While monoclonal antibodies have shown promise in targeted cancer therapy (16, 17), they also come with drawbacks like immunogenicity, high production costs, and limited tumor tissue penetration due to their large size. Effective cancer treatment requires specific properties in monoclonal antibodies, including specificity, solubility, stability, and smaller size. Efforts have focused on producing antibody fragments like scFV and Fab, which offer advantages such as enhanced tumor penetration, reduced immunogenicity, and faster production. However, challenges remain in terms of stability, expression yield, aggregation, and protease resistance, necessitating further improvements (38). In the camelid family, unique immunoglobulins lacking light chains are found in the mammalian immune system. These heavy-chain antibodies feature a VHH domain, which maintains antigen-binding ability akin to full antibodies while overcoming the challenges of conventional antibodies and engineered fragments. Their exceptional characteristics include high stability and solubility, ease of production, small size, heat, detergent, and protease resistance, high homology with human VHH fragments, high antigen affinity, ease of humanization, and engineering into multi-specific forms. Due to their small size, VHHs are expected to penetrate tumors and the retina more effectively than other antibodies. Moreover, VHHs are the only option among antibodies and their derivatives capable of crossing the blood-brain barrier. Therefore, VHHs with VEGF inhibition potential hold promise for angiogenesis inhibition in brain tumors as well (39, 40). Given the extraordinary importance of angiogenesis inhibition in cancer and other diseases, the remarkable success of monoclonal antibodies against VEGF in this field and the superiority of VHHs over other antibodies and antigen-binding fragments have been established. In this study, a surface display system using the INP linker was employed to produce VHH antibodies with high specificity and affinity against VEGF in the bacterial system. The use of a surface display system has various advantages, including low cost, easy expression, and ease of control over expression conditions (41). In this study, we employed a surface display system using the INP linker to produce VHH antibodies targeting VEGF in bacteria, addressing the challenges associated with bacterial cytoplasmic expression (40). The INP-based system offers advantages such as low cost, easy expression, and control over expression conditions. Additionally, the central repetitive region in INP can be removed to produce shorter fusion proteins for cell surface display (42). Despite size limitations in some systems, INP allows expression of proteins up to 60 kD. Various variants of INP exist, with Ina-K being the most commonly used (43), so in this study, the N-terminal region of InaK, which contains the first 537 amino acid pairs of Ina-K, was employed as an anchor motif for displaying VEvhh₁₀ on the surface of bacterial cells. In a 2015 study, Shahangian et al. designed and constructed phages displaying single-domain antibodies targeting the region linked to the VEGF receptor. These phages exhibited binding capability to key functional regions. A phage display library on a nanobody platform was prepared, followed by enrichment and competitive screening of VHHs targeting VEGFR-II using competitive ELISA. Monoclonal VHHs with the highest affinity for the second binding domain of the VEGF receptor were sequenced and named VEvhh1, VEvhh2, and VEvhh3 (VEvhh10) based on their recurrence frequency. The gene sequences encoding these VHHs are deposited in GenBank with accession numbers LC010467, LC010468, and LC010469, respectivel(19).The results of this research indicate that the use of the surface display system with the INP linker for expressing VEvhh10 is a suitable option. This system completely eliminates the need for cell lysis and time-consuming, costly chromatographic methods. With this system, it is possible to express VEvhh10 as shown (Figure 5). Furthermore, the ELISA results and the cell proliferation assay (live-cell assay) confirm that VEvhh₁₀ binds with high affinity to the VEGF receptor binding region, as shown in the (Figure 7.b). Ultimately, a previously unexplored INP, InaA, was successfully used to display VEvhh10 on the cell surface of E. coli BL21 (DE3) (Figure 1.c). The InaK-N_TEV Protease_Cleavage_Site_ VEvhh10 detected on SDS-PAGE was 33 kD, exactly as expected. The expression of VEvhh10 on the bacterial cell surface was verified using the INP Linker.  An immunological examination was conducted using an ELISA-based immune assay to measure VEGF concentration in the presence of different VEGF concentrations. As indicated in (Figure 7.b), the results demonstrated that increasing VEGF concentration led to a higher number of anti-VEGF molecules binding (VEvhh10 expressed on the bacterial cell surface), resulting in enhanced optical absorption. This study shows that it is possible to overcome the problems of cytoplasmic expression in bacteria by using a surface expression system. This system transfers VEvhh10 to be expressed on the bacterial cell surface using a linker INP, thus overcoming the problem of incorrect folding inside the bacteria. The information obtained from this study introduces VEvhh10 as a suitable candidate for inhibiting VEGF. It has the capability to block the key functional site of VEGF, inhibiting its binding to its receptor and consequently preventing the cascade of its signaling. However, further studies and investigations are required to validate this proposal.

Acknowledgment

The Researcher expresses sincere gratitude to the Research Deputy of Tarbiat Modares University for providing laboratory facilities and financial support.

INTRODUCTION

The COVID-19 pandemic in recent years has placed a huge burden on health care systems worldwide, as well as intriguing health personnel and scientists who stood obscured with its wide-ranged clinical phenotype in patients, i.e. from regular influenza symptoms to acute respiratory distress syndrome (ARDS), and possible death [1,2]. Moreover, the infection with corona virus was accompanied by severe inflammatory and immune responses, represented by a cytokine storm, often leading to severe lung damage and requiring patient admission to intensive care units (ICUs) and mechanical ventilation at local hospitals [3,4]. The main cellular receptor for corona virus, which facilitates viral entry into cells, is angiotensin converting enzyme 2 (ACE2), a cellular receptor and a main component of the renin-angiotensin-aldosterone system (RAAS), with enzymatic activity that hydrolyzes angiotensin-II (Ang-II) into Ang-1-7 [5,6]. A second important player in the RAAS system is angiotensinogen (AGT), a peptide hormone encoded by the AGT gene, which is cleaved by the renin enzyme to produce angiotensin I (Ang-I). The enzyme angiotensin (ACE or ACE1) then converts Ang-I to Ang-II [7,8].  Ang-II binds to the AT1 receptor, mainly associated with vasoconstriction, fibrosis, inflammation and thrombosis. On the contrary, Ang-1-7, resulting from ACE2 hydrolysis of Ang-II, binds to the AT2 receptor, resulting in dilation of blood vessels and reduction of fibrosis, inflammation, and thrombosis. Thus, ACE2 produces a protective response in the lung, while high ACE activities are associated with lung and cardiovascular diseases by increasing the activity of the Ang-II/AT1R axis [5,9]. Since the beginning of the COVID-19 pandemic, a plethora of scientific reports have highlighted the importance of age and several comorbidities, including obesity and hypertension, in worsening the clinical phenotype in COVID-19 patients, linking the disruption of homeostasis in the RAAS, the immune responses, and other physiological systems to severe clinical outcomes [8,10]. Many other reports have revealed associations between COVID-19 severity and genetic variants in genes associated with the RAAS including ACE, AGT and ACE2 [11-15].  Among the key player genes that received much attention after the pandemic was the ACE2 gene. On one hand, many genetic polymorphisms were identified in ACE2 that could change the binding affinity of the corona virus spike protein, hence, increasing or decreasing its entry into target cells [12]. On the other hand, and because of ACE2 major involvement in RAAS regulation, several ACE2 gene polymorphisms were identified and linked to predisposing COVID-19 patients to comorbidities that could worsen their clinical path [16,17]. One intronic single nucleotide polymorphism (SNP) in ACE2, rs2074192, has been linked to hypertension and severity of COVID-19 [18-21].  Another intronic SNP in ACE2 gene, rs233574, has been linked to stability of ACE2 mRNA and protein [22,23]. Moreover, few reports identified an exonic SNP in the AGT gene, rs699 or M268T, which replaces methionine residue with threonine in the angiotensinogen peptide and was showed to be associated with increased susceptibility to COVID-19 [7,24]. Nevertheless, it appeared that the effects of the three aforementioned SNPs in ACE2 and AGT genes on COVID-19 severity were correlated with the studied population ethnicities, as data linked to the involvement of these SNPs in COVID-19 morbidities and co-morbidities often came contradictory, taking into consideration the varied allelic frequencies among different ethnic groups. Hence, in this report, we studied the association of the two SNPs in the ACE2 gene, rs2074192 and rs233574, in addition to the AGT rs699 SNP, with COVID-19 disease severity in a cohort of Syrian patients whose corona virus infection was previously confirmed by standard methods. We reported the allele, genotype and haplotype frequencies of the three polymorphisms in both sexes after categorizing the patients according to obesity, hypertension and COVID-19 severity.

MATERIALS AND METHODS

Subjects and Samples

Our retrospective cohort study included 54, 24 females and 30 males, non-related participants with previously confirmed COVID-19 positive disease, by PCR positive tests (22 cases) or positive chest X-ray in addition to clinical symptoms (22 cases) or positive Corona IgG (10 cases). The Study cases were classified based on 3 categories: blood pressure into (39 normotensive NT) and (15 hypertensive HT); obesity, reflected by  body mass index (BMI), into (20 lean, BMI<25) and (34 overweight OW, 25<BMI<30 and  obese OB, BMI>30); and finally COVID-19 status into (21 mild cases, mild symptoms) and (33 moderate cases including 17 with intense symptoms but oxygenation level >94, and 13 severe cases with intense symptoms, and 3 cases with life-threatening conditions and oxygenation level <94). Our study was approved by both the Bioethics Committee at the Faculty of Pharmacy – Damascus University, and the National Committee for Ethics of Scientific Research and Novel Technologies (CONEST), at the Higher Commission for Scientific Research. Informed consents were obtained from all subjects prior to their enrollment. Three milliliters of peripheral blood were collected on Ethylene Diamine Tetra-acetic Acid (EDTA) and stored at -20 °C.

DNA Isolation and Amplification

Molecular work and genotyping processes were performed at the pharmaceutical biotechnology and immunology laboratories- National Commission for Biotechnology, Damascus, except for DNA sequencing. Genomic DNA was isolated from blood samples using Qiagen blood DNA extraction kit (Qiagen, USA) according to the manufacturer’s protocol. DNA concentration and purity were assessed using Nano drop (Maestrogen®, Taiwan). The extracted DNA quality was verified by horizontal 1.5% agarose gel electrophoresis, followed by gel staining with ethidium bromide staining (Promega®, USA), and gel documentation (Cleaver, UK). We performed polymerase chain reaction (PCR) amplification using two sets of specific primer pairs. For both ACE2 rs2074192 and rs233574, we used forward primer 5` CAGCAAAGGGGACACTTAGACA 3` and reverse primer 5` AGCCATTTCCCATCCCAGTG 3`, with a theoretical expected amplicon size of 707 base pair (bp).  For AGT rs699, we used forward primer 5` GTGGTCACCAGGTATGTCCG 3` and reverse primer 5` TATACCCCTGTGGTCC TCCC 3`, with an expected amplicon size of 291 base pair (bp). All primers were manufactured by (Eurofins, Belgium), and were designed using Primer 3 software tool and checked prior to ordering using the MFE primer bioinformatics tool (https://mfeprimer3.-igenetech.com/spec) to evade any non-specific binding to genomic DNA. PCR was performed according to standard methods using thermal cycler (SENSEQUEST®, Germany) and 2X Master Mix (Genedirex®, Taiwan). The PCR reaction mixture contained 20 ng of genomic DNA and 0.25 µm/l of each primer. PCR amplification was performed according to the following protocol including: initial denaturation for 5 min at 95° C, 35 cycles of (30 sec at 94° C, 30 sec at 57° C, and 1 min at 72° C), and a final 10 min at 72° C for final extension. PCR amplicons were analyzed by agarose gel electrophoresis, using an electrophoresis apparatus from (Cleaver, UK) and a 100 bp DNA size marker from (Genedirex®, Taiwan). DNA Sequencing was performed at (Macrogen, South Korea) according to standard protocols.

Bioinformatics & Statistical Analyses

Sequencing chromatograms were analyzed using a bioinformatics tool (Geneious® software, USA). Genotype frequencies of sample alleles were estimated by gene counting method. Statistical analyses were performed using chi-square calculator https://www.socscistatistics.com/tests/  to compare the ratios of allele and genotype frequencies, respectively, with a p-value <0.05 as significant. Finally, EXCEL T test calculator was used to compare means of age and BMI among study cases, with a p-value <0.05 for statistical significance.

RESULTS

Subjects

No significant differences were recorded concerning age and body mass index (BMI) of females and males, (Table 1). However, when subjects were divided according to blood pressure status and classified as NT and HT groups, both age and BMI were significantly higher in HT (40 yrs. and 36.8 kg/m2) compared to NT (46.7 yrs. 29.7 kg/m2), respectively, (Table 1). Additionally, overweight (OW) and obese (OB) subjects showed a significantly higher mean age (49.6 yrs.) compared to lean subjects (age 34.4 yrs.). Finally, subjects with moderate or severe COVID-19 conditions (MOD/SV) were significantly older than those with mild conditions (48.5 versus 36.6 yrs., respectively), while no significant difference appeared in BMI between MOD/SV and mild conditions.

Genotyping

Amplification of the ACE2 and AGT gene sequences was successful, with amplicons appeared with expected molecular weights (MW), ~ 700 bp for ACE2 and between 200 and 300 bp for AGT, (Fig. 1 a). For all three SNPs, homozygotes and heterozygotes were easily identified by reading the sequencing chromatograms; (GG/CC, AA/TT, or AG/TC) for rs699, (CC, CT, or TT) for rs2074192, and (TT, CC, or CT) for rs233574, (Fig. 1, b-d).

Allele Frequencies

After reading all sequencing chromatograms, alleles for all three SNPs were counted and recorded for either females or males included in any of the three categories; blood pressure, obesity, and COVID-19 condition. Of note, and since ACE2 gene occurs on X chromosome whereas AGT occurs on an autosome, for both rs2074192 and rs233574 we counted two alleles in females but only one allele in males, while for rs699 we counted the two alleles in both females and males. Table 2 shows the number of alleles in females and males recorded for each of the three SNPs, and according to the distribution of the study subjects in the three categories. The only recorded significant difference was in rs699 when comparing the T and C allele frequencies between lean versus OW/OB females, where the C allele was significantly higher in OW/OB females compared to lean females, p=0.043.

Noteworthy, a higher rs699 C allele frequency was recorded in HT compared to NT female subjects, a higher rs2074192 C allele frequency was recorded in OW/OB compared to lean subjects, a higher rs233574 C allele frequency was recorded in lean compared to OW/OB subjects, and a higher rs2074192 C allele frequency was recorded in both female and male subjects with MOD/SV compared to mild COVID-19 conditions, although none of the comparisons reached significance, p>0.05.

Genotype Frequencies

Genotypes were counted and recorded for all three SNPs. In all three categories, no significant differences were detected vis-à-vis genotype frequencies among NT and HT, lean and OW/OB, or mild and MOD/SV phenotypes. Fig. 2 shows genotype frequencies in the COVID-19 condition category for rs699 in both females and males, while it shows genotype frequencies for rs2074192 and rs233574 only in females. Since ACE2 occurs on the X-chromosome, the genotypes for either rs2074192 or rs233574 in males are the same as the allele frequencies shown in Table 2. Of note, the rs2074192 CC genotype appeared in 7 out of 14 female subjects with MOD/SV condition (50%) compared to 3 out of 10 female subjects (30%) with mild condition; the rs699 CC genotype appeared in 3 out of 14 female subjects with MOD/SV condition (21.5%) while no female had this genotype in the mild condition population; and finally the rs699 TC genotype appeared in 9 out of 19 male subjects with MOD/SV condition (47.4%) while it appeared in only 1 male out of 11 male subjects (9.1%) with mild condition.

Haplotype Frequencies

The distribution of possible haplotypes including rs2074192, rs233574, and rs699 in either female or male subjects was counted and their frequencies recorded (Tables 3 & 4). Table 3 shows the haplotype frequencies when only two SNPs are taken separately; i.e. rs2074192 and rs699, or rs2074192 and rs233574, while Table 4 shows the haplotype frequencies for all three SNPs together.

ACE2 rs2074192 – AGT rs699 Haplotypes

Table 3(a) shows all 9 possible haplotypes (3²) for females and all 6 haplotypes for males. In females, the most common haplotype when considering both rs2074192 and rs699 polymorphisms was CC-TC, respectively. Among the three categories, the highest difference in haplotype frequencies was detected for TC-TC haplotype between the lean (16.7%) and OW/OB (41.7%) groups. The TT-CC haplotype was not recorded in female subjects. In males, the highest recorded haplotype for rs2074192 and rs699 was C-CC, respectively. Moreover, 6 out of 19 male subjects with MOD/SV condition had the C-TC haplotype, while no males out of 11 were recorded with this haplotype in male subjects with mild conditions. Similarly, 3 OW/OB male subjects had the C-TT haplotype, while no lean males were recorded with this haplotype.

 

ACE2 rs2074192 – ACE2 rs233574 Haplotypes

Table 3(b) shows all 9 possible haplotypes (3²) for females and all 4 haplotypes for males. In females, the most common haplotype when considering both rs2074192 and rs233574 genotypes was TC-TC, respectively. In addition, 4 females (33.3%) had the CC-TT haplotype in the OW/OB groups, while no females had this haplotype in the lean group. Reversibly, 3 females (25%) had the CC-TC haplotype in the lean groups, while no females had this haplotype in the OW/OB group. In males, the highest recorded haplotype was C-T. Moreover, the highest difference among haplotype frequencies was detected for C-C haplotype in the mild (1 male, 9.1%) and MOD/SV (6 males, 31.6%) groups.

ACE2 rs2074192 – ACE2 rs233574 – AGT rs699 Haplotypes

Table 4 shows the 12 recorded haplotypes out of the 27 (3³) possible haplotypes in females and 9 recorded haplotypes out of 12 possible haplotypes for males. In females, the most frequent haplotype among the three categories was TC-TC-TC. In addition, 3 females (25%) in the OW/OB group showed the CC-TT-TC haplotype, while no females showed this haplotype in the lean group. Contrariwise, 3 females (16.7%) in the NT group showed the CC-TT-TC haplotype, while no females showed this haplotype in the HT group. One female had the CC-TT-CC haplotype in all three groups: HT, OW/OB and MOD/SV. Of note, 15 possible haplotypes were absent in females including TT-CC-TT. In males, the highest recorded haplotype in the three categories was C-T-CC. In addition, the highest differences among haplotype frequencies were detected for C-T-TC and T-C-TC haplotypes, where 4 males (21%) in the MOD/SV groups have C-T-TC in comparison with none in the mild groups, and 3 males (15.8%) in the MOD/SV groups have T-C-TC in comparison with none in the mild groups.

Finally, among the MOD/SV group, three females aged (55, 76 and 86), and with BMI (25, 34, and 26) had a life-threatening condition that required their admission to the ICU at a local hospital. The haplotypes of the four subjects were (TC-TC-TC), (CC-CC-TC), (CC-TT-CC).

DISCUSSION

Age, Obesity, and Sex of Study Subjects

We recorded no significant differences in mean age or BMI between the 24 females and the 30 males included in this study. However, normotensive subjects were clearly younger and leaner than hypertensive subjects (Table 1). In fact, it is well known that aging and obesity are independent risk factors for raised blood pressure levels [25,26]. Moreover, it has been reported that overweight occurring at a younger age at onset is associated with a significantly increased risk of hypertension with the highest relative risk among individuals aged 18–39 years as onset of overweight [27]. As for COVID-19 severity, subjects with moderate and severe conditions were significantly older but not more obese than those with mild conditions (Table 1). In fact, the severity of COVID-19 is known to be associated with specific pre-existing conditions including age, sex, obesity, hypertension and genetic susceptibility, with mortality occurring mostly in the elderly and being about twice as high in males as in females [18,28].  Although no significant difference in BMI was found between subjects with mild compared to MOD/SV conditions (Table 1), it is noteworthy that 22 out of 30 males (73.3%) and 12 out of 24 females (50%) were overweight or obese (Table 2). This made the majority of subjects enrolled in this study as OW/OB, with the mean BMI in this group (26.9 kg/m2) already in the overweight range, and probably justifies the absence of differences in BMI between subjects with mild and MOD/SV COVID-19 conditions. Of note, no differences were found regarding sex distribution after classification of study subjects according to blood pressure and COVID-19 severity (Table 2); females (NT 75%, HT 25%; Mild 41.7%, MOD/SV 58.3%) and males (NT 70%, HT 30%; Mild 36.7%, MOD/SV 63.3%).

ACE2 rs2074192 C>T

The rs2074192 polymorphism is a variation in intron 16 of the ACE2 gene located on the X chromosome, with a global C allele frequency around 56.9% and a T allele frequency around 43.1%, European (C 55.3%, T 44.7%), African (C 68.4%, T 31.6%), and Asian (C 57.9%, T 42.1%), (www.snpedia.com). Pouladi and Abdolahi showed in silico a major effect of this SNP on the secondary structure of ACE2 RNA [23], suggesting a possible dysregulation of ACE2 transcription or translation and protein stability, and leading to a decrease in SARS-CoV-2 viral entry. In fact, many previous reports have recorded an association, although controversial, between rs2074192 with hypertension and COVID-19 severity [11,17,19,20,29]. In the Chinese population, Luo et al. demonstrated that the rs2074192 T allele was associated with essential hypertension in Chinese patients [11]. Moreover, Pan et al. reported that individuals with TC or TT genotype were associated with essential hypertension [29]. Sheikhian et al. showed that the ACE2 rs2074192 TT genotype was associated with the COVID-19 mortality in Iranian COVID-19 patients [20].  On the contrary, in Mexican patients, Martinez-Gomez et al. reported a higher C allele frequency and CC genotype frequency in COVID-19 patients with severe and critical conditions [17]. Similarly, Molina et al. showed that the T allele was protective against COVID-19 severity in a cohort of Italian patients [19].  These previous reports highlight the differences in genetic composition among different ethnicities and raise the importance of examining SNP distribution among other populations, including Syrians. Despite the fact that no significant differences were found in the current study when comparing rs2074192 allelic and genotypic frequencies between female and male subjects, the data suggest a modest association between the C allele with hypertension, obesity and COVID-19 severity as allele frequencies were higher in hypertensive females compared to normotensive peers (p value = 0.3), in OW/OB females compared to lean subjects (p value = 0.066), and in female and male subjects with MOD/SV conditions compared to those with mild conditions (p value = 0.13, and 0.12, respectively) (Table 2). In addition, the CC genotype frequency was higher in female subjects with MOD/SV compared to those with mild conditions (Fig. 2). These data are consistent with a protective effect of the T allele possibly by reducing the effect of the ACE2 enzyme that hydrolyzes Ang-II and prevents the latter’s contribution to vasoconstriction, fibrosis, inflammation, and thrombosis [8], whereas the C allele or CC genotype could be considered as risk factors.

ACE2 rs233574 T>C

The rs233574 polymorphism is an intronic variation in the ACE2 gene on the X-chromosome, with a global T allele frequency around 51.8% and C allele frequency around 48.2%, European (T 50.5%, C 49.5%), African (T 69.1%, C 30.9%), and Asian (T 30%, C 70%), (www.snpedia.com). Similar to rs2074192, the rs233574 theoretically affects the RNA secondary structure possibly leading to destabilizing the ACE2 transcript and protein [22,23].  Nevertheless, the T reference allele may additionally enhance the affinity for binding ETR-3 splicing factor, thus increasing susceptibility for COVID-19 [30].  Interestingly, most ethnic populations have comparably mid or low C allele frequency, while its frequency in the Chinese population could reach 70%, hence this allele could have been played its protective role in a large number of Chinese COVID-19 patients, although no clinical data are available to support the protective role of rs233574. Likewise, data from our study might support a protective effect for the C allele, while the T allele is a risk factor. In fact, higher T allele frequencies were detected in hypertensive females (50%) and males (55.6%) compared to normotensive peers (38.9% and 42.9%, respectively), although with no significance (p value > 0.05), and in OW/OB compared to lean female subjects (p value = 0.079), while very similar C and T allele frequencies were found in female and male subjects with MOD/SV compared to those with mild conditions (p value = 0.85) (Table 2). Finally, the TT genotype frequency was higher in female subjects with MOD/SV compared to those with mild conditions (Fig. 2).

AGT rs699 T>C

This polymorphism occurs on exon 2 in the AGT gene on chromosome 1, leading to replacement of a methionine residue with threonine in the 268 position within the primary protein structure, with a global T allele frequency around 54.5% and a C allele frequency around 45.5%, European (T 57.9%, C 42.1%), African (T 18.1%, C 81.9%), and Asian (T 17.5%, C 82.5%), (www.snpedia.com). In fact, the rs699 C allele has been reported to be associated with increased plasma angiotensinogen levels, leading to hypertension [7].  Several previous reports showed a significant association of rs699 with hypertension and/or COVID-19 severity [24,31-35]. Specifically, Mirahmadi et al. found that the rs699 C allele is a predisposing variant for coronary artery disease (CAD) in the Iranian population [32]; Repchuk et al. found that the rs699 C allele was associated with a 2.5-fold increase in systolic and diastolic BP in Ukrainian patients [33]; Yako et al. found an association between rs699 and hypertension in Tunisian and South African patients [34]; Cafiero et al. found a higher allele C (45%) and CC genotype (22%) frequencies in symptomatic compared to asymptomatic (C 31%, CC 0%) Italian COVID-19 patients [31]; and Kouhpayeh et al. demonstrated that the TC genotype and the C allele of AGT rs699 increased the risk of COVID-19 infection in Iranian COVID-19 patients [24]. Finally, Khamlaoui et al., found that rs699 was associated with high BMI, waist circumference and overweight/obesity [35]. Data from our current study demonstrated the presence of a higher rs699 C allele frequency in hypertensive compared to normotensive, OW/OB compared to lean, and MOD/SV compared to mild COVID-19, although with larger differences in females compared to males, and reaching significance only when comparing OW/OB females with lean females, p=0.043, (Table 2). In addition, the CC genotype appeared in 3 females in the MOD/SV group compared to none in the Mild groups (Fig 2). Hence, from these data, rs699 C could be extrapolated as a risk allele while T as a protective allele in relation to COVID-19 severity. Notably, all subjects included in our study were infected by COVID-19, although with a range of symptoms. Hence, comparing the allele frequencies in our subjects for all three SNPs with those previously reported in different ethnicities and populations would probably be imprecise, especially when taking into account the large differences in allele frequencies among different populations, as in the case of rs233574 and rs699. Nevertheless, when considering the allele frequency values in normotensive female subjects (Table 2), we could find out allelic frequencies of rs2074192 similar to those in most ethnicities, allelic frequencies of rs233574 similar to those in Asians but not in Europeans and Africans, and slightly higher allelic frequencies of rs699 compared to those in Europeans, but soundly different from their frequencies in Africans and Asians. In fact, the deviation of allelic frequency in the Syrian population documented in this study is not surprising taking into consideration the geographical location of Syria amid the three continents, where the genetic composition of Syrians is expected to be unique compared to most other populations because of migration and breeding influenced by several factors over thousands of years. Nonetheless, a future study reporting the allelic frequencies of all three SNPs in healthy Syrian controls would result in accurate estimates of SNP frequencies. On the other hand, it was interesting to note that the differences in allelic frequencies for all three SNPs were significant or close to significance with small p-values, only when comparing these frequencies in the obesity but not in the blood pressure and COVID-19 condition categories, specifically between lean and OW/OB female subjects (Table 2). In fact, it is very well documented that visceral obesity is a risk factor for cardiovascular disease, metabolic syndrome, hypercoagulability and vitamin D deficiency, all of which are hallmarks for COVID-19 severity [15,36,37]. Recently, Steenblock et al., identified several factors involved in the mechanism by which obesity affects COVID-19 outcome, including physical stress on ventilation, increased risk of pulmonary fibrosis, impairment of the immune system and accumulation of macrophages in adipose tissues, increasing adiponectin levels that can stimulate macrophages production of pro-inflammatory cytokines such as TNF-α, IL-6 and IL-1β, and finally activating the RAAS leading to increased blood pressure, atherosclerosis and thrombosis [38]. One could postulate that possible effects of rs2074192, rs233574, and rs699 on either blood pressure levels and/or COVID-19 severity could be occurring via indirect involvement of obesity-dependent biochemical pathways. This could be further tested on a large number of individuals who suffered from severe COVID-19 disease. Equally remarkable are the sound differences in the allele frequency profiles for all three SNPs between females and males within the obesity category (Table 2), in addition to the different distribution of rs699 genotypes between females and males within the COVID-19 category (Fig. 2). Actually, similar differences were previously reported not only for X-linked gene polymorphisms, but even for genes located on autosomes. For example, Hamet et al. showed that the T allele of rs2074192 was associated with hypertension only in obese males, while reporting a significant interaction with obesity of another SNP in the ACE2 gene, rs233575, but only in females [18]. On the other hand, Repchuk et al. showed that the rs699 C allele was associated with high systolic and diastolic blood pressure only in females [33].  As a matter of fact, sex related genotype-phenotype interactions are highly complicated and was previously tackled by many researchers. Indeed, endocrine status, in addition to genetic composition, vitally affects phenotypes and could be influenced by several factors, including differences in hormonal levels and even lifestyle habits, such as smoking and alcohol consumption, etc [39-41].

Haplotypes

Similar to the aforementioned differences in allelic and genotypic frequencies among females and males, distribution of haplotypes varied between the two sexes (Tables 3 & 4). This was clear in the different distribution of the most common haplotypes in females and males; for rs2079142-rs699, CC-TC in females, and C-CC in males; for rs2079142-rs233574, TC-TC in females and C-T in males; and for rs2079142-rs233574-rs699, TC-TC-TC in females and C-T-CC in males. This could certainly contribute to the phenotypic differences between the two sexes and explain the distinct association of certain alleles, genotypes, and haplotypes with blood pressure, obesity, and COVID-19 severity. Table 5 summarises the clearest differences in haplotype distribution among the two sexes demonstrated in Tables 3 and 4.

A review of Table 5 highlights one important finding: different haplotypes were associated with obesity only in female subjects, whereas other haplotypes were associated with COVID-19 conditions only in male subjects. Once again, this eludes to the disparity between the two sexes in terms of genetic composition and its phenotypic effects. Several preliminary conclusions might be drawn from Table 5: the rs2074192 CC genotype is probably associated with obesity in females; the rs699 TC genotype is probably not associated with either obesity or COVID-19 severity, as it was commonly distributed among females and males; the rs233574 TT or TC genotypes are probably associated with obesity; the rs2074192 C allele is associated with obesity in females and COVID-19 severity in males; and the rs2074192 T allele could be protective. Nonetheless, further studies should be performed to check for the validity of these proposals. Finally, two haplotypes were overrepresented in the HT compared to NT subjects (Table 3); the rs2074192-rs699 C-CC haplotype in males, the rs2074192-rs233574 TC-TC haplotype in females. In both cases, this could be due to the presence of the rs2074192 C allele that has previously been reported to be associated with hypertension in COVID-19 patients [17,19]. Taken together, and suggesting that the rs2074192 C allele, the rs233574 T allele, and the rs699 C allele, as risk alleles for COVID-19 morbidity and/or comorbidities, one could hypothesize that the most risky haplotype would be CC-TT-CC in females, and C-T-CC in males, while the most protective haplotype would be TT-CC-TT in females, and T-C-TT in males. Indeed, the fact that we recorded only 12 out of 27 possible haplotypes in our female population (Table 4), while the rest 15 unfound haplotypes included the TT-CC-TT haplotype might support our proposed haplotype functional classification. On the contrary, life-threatening cases could have haplotypes identical or similar to the risky haplotypes we proposed. In fact, three cases in our study population had life-threatening conditions that required them to be admitted to the ICU at local hospitals. The haplotypes of these three female subjects were (TC-TC-TC), (CC-CC-TC), (CC-TT-CC), i.e., one identical and two close haplotypes to the proposed most risky haplotype CC-TT-CC. Nonetheless, the three female subjects were elderly with ages (55, 76 and 86) and BMI (25, 34, and 26), so it is not possible to isolate the possible effect of age on COVID-19 severity in these individuals.

CONCLUSIONS

In this study, the allele, genotype and haplotype frequencies of three single nucleotide polymorphisms, ACE2 rs2074192, ACE2 rs233574, and AGT rs699 were recorded in a cohort of Syrian subjects who had previously suffered from COVID-19 disease with variable symptoms and comorbidities. We found significant association between rs699 and obesity in the female subject, while the other two SNPs showed reasonable association but without statistical significance. Based on our data and those from previous reports, we proposed the C allele for rs2074192, the T allele for ACE2 rs233574, and the C allele of AGT as risk factors for obesity and COVID-19 severity, although the association with obesity was shown only in female subjects while the association with COVID-19 severity was shown only in male subjects. We also proposed two haplotypes, rs2074192-rs233574-rs699 (CC-TT-CC in females, and C-T-CC) as risky combination for COVID-19 severity, while two haplotypes (TT-CC-TT in females, and T-C-TT in males) as protective. Our study has two main limitations; the first is the small number of studied subjects, which might have obscured significant associations. The second limitation is related to the retrospective nature of our study, which did not allow us to follow the clinical outcomes of the subjects.

ACKNOWLEDGEMENT

The authors thank Ms. Reham Antaki for her superb technical assistance.